Sequence and Plasmid Archive

Adeno-associated virus (AAV) has emerged as a highly promising vector for human gene therapy due to its favorable safety profile, versatility, and ability to transduce a wide range of tissues. However, natural AAV serotypes have shortcomings, including suboptimal transduction efficiency, pre-existing immunity, and a lack of tissue specificity, that hinder their therapeutic potential. To address these challenges, significant efforts are being applied to engineer novel AAV capsids.

The following table contain a list of RepCap plasmid (encoding AAV Rep and respective capsid protein which determines the AAV serotype) that are useful to produce natural or engineered novel AAV. You can search or sort this table based on plasmid name, species, gene name and order the RepCap plasmid immediately.

Check out our Pre-made AAV and learn about our options for hundreds of in-stock preps that are ready to ship right away, as well as our AAV Production Service to give you more flexibility.

Name MutationsEngineering strategyTropismFold improvementParental serotype
pAAV9.HRH527Y,R533SRDCNS200-fold decreased liver TEAAV9
pAAVhum.8mutations in VR-IV, VR-V, VR-RDliver10-fold increase TEAAV8
pAAV.CPP.16TVSALK insertion at 588/589RDCNS1.9-fold increase TEAAV9
pAAV r2.15E12A, K258N,N5871 T716A,T567SDEliver, muscle,96-fold increased AEAAV2
pAAV SCH958 total mutations; 92% identityDENSCs,12-fold increased TEAAV9
pAAV 2.7m8LALGETTRP insertion at positionDEretina5-fold increased TEAAV2
pAAV R10010 amino acid peptide insertion atDEretina2.6-3.75-fold increased TEAAV2
pMyoAAV2A10-mer insert at hypervariable region VIIIDEskeletal128-fold increased TEAAV9
pAAV-KP1chimeric capsid from multipleDEpancreatic5-10-fold increased TEchimeric
pAAV V66K39Q, V151A,R447K, T450A,NDCNS~13-fold increased TEAAV2
pAAV-PHP.eB7-mer insertion (TLAVPFK)DEneurons1.5- to 4-fold increased TEAAV9
pAAV Cap.Mac21-bp insertion after Q588 in AAV9DEneurons45-fold increased TEAAV9
pAAV.K20VSGRREG substitution at positionDEkidney9-fold increased expressionAAV9
pAAV-Spark100Derived from AAVrh74DE/RDliver8-12 increased SPAAVrh74
pAAV A101chimera reconstruction from AAV1, AAV2, AAV4, AAV6 and AAV9DElung32-fold increased AE, 4-fold
increased TE
chimeric
pAAV2tYFthree tyrosine-to-phenylalanine
(YF) mutations in AAV2 capsid
RDretina>30-fold increased TE in ganglion cellsAAV2
pAAV Anc80ancestral sequence reconstructionRDretina~1.77- to 4.5-fold higher TEchimeric
pAAV LK03capsid shuffledDEliver1.96-fold increased TEchi meric
pAAV rh.10Rep2/Cap-rh10DEneurons1- to 14-fold higher gene deliveryRhesus macaque
pAAV Olig001Olig001 capsid gene / rep 2DECentral Nervous System9-fold greater bindingcontains a chimeric mixture of AAV1, 2, 6, 8 and 9
pAAV S3preferentially targets the human liverRDGaucher10-fold increased gene deliveryAAV8,AAV5
pAAV 4D-C102LANKTTNKDA insertion at position 588 of AAV2, V708 mutationDECardiac and Skeletal Muscle12-fold increased expressionAAV2
pAAV DJ262 NSTSGGSSN 270DELiver9-10-Fold increased TEAAV-2/8/9
pAAV 2.5Ta chimera between AAV2 (aa1–128) and AAV5 (aa129–725) with one point mutation (A581T)DEHuman airway epithelium100-fold increased gene transferAAV2,AAV5
pAAV 2i8G9585-NLQQQN-590 and Q464V, A467P,D469N, I470M, R471A, D472V, S474G, Y500F, and S501A were mutatedRDMuscle200-fold decreased than AAV9 in liverAAV2
pAAV 2i8585-NLQQQN-590RDMuscle10-fold increased tenfold increases in transduction efficiencyAAV2
pAAV 9.45N498Y,L602FDECardiac and musculoskeletal10-25 fold decrease in liverAAV9
pAAV 9.61N498IDECardiac and musculoskeletal10-25 fold decrease in liverAAV9
pAAV BL1547 aa(TGRVDSR) insertion after Q588 in AAV9 capmachine learningLiver transduction1000-fold increased TEAAV9
pAAV HRHY446H、N470R 、W503HDECardiac6-fold reduction in liver RNA expression and a 10-fold increase in cardiac RNA expressionAAV9
pMyoAAV 1ARGDLTTP insertion betweem 588 and 589DEMuscle fibers and cardiomyocytes14-fold higher EGFP mRNA expressionAAV9
pMyoAAV 4ASNSRGDYNSL insertion betweem 585 and 586DEMuscletransduced human primary myotubes with particularly high efficiencyAAV9
pAAV MYORGDLGLS insertion at 599DEMuscle61-, 17-, or 11-fold increases in the diaphragm, quadriceps femoris, or heart, respectively.AAV9
pAAV r3.45insertion of LATQVGQKTA (LA and A are linker residues) at aa587 with an V719M mutationDENeural stem cells14.4-50-fold increase in infectionAAV2
pAAV TR27-mer peptide(RTTASLM) inserts between amino acids 588 and 589 of VP1DEspinal cord8-fold increaseAAV9
pAAV.cc47452-GVSLGGG-458DEheart, tibialis anterior, and brain21-, 16-, and 2-fold higher fluorescence intensity in the heart, tibialis anterior, and liverAAV9
pAAV.GT5S472A、S587A、 N706ADEliver50-fold higher TEAAV3B
pAAV.k13452-MVEGRMG-458DEkidney40-fold increased TEAAV9
pAAV.KK04A264, T266 etc.DEcardiomyocytesrAAV.KK04 was the best-performing vector in human-based screening platformsAAV3
pAAV1P4Insert NDVRSAN after aa588DEfibers100-fold increased TEAAV1
pAAV2.A1T456I,delete R459DEcentral nervous system10–15 times higher than that of AAV2AAV2
pAAV2.A2R447M, T456SDEcentral nervous system10–15 times higher than that of AAV2AAV2
pAAV2.GLInsertion GLSPPTR between N587 and R588DERetina13.4-fold increase in transcriptionAAV2
pAAV2.NNInsertion NNPTPSR between N587 and R588DERetina12.1-fold increase in transcriptionAAV2
pAAV2.MB453Insertion RDVLPGTDELiverSignificantly reduced CD8+ T cell responses against the transgene productAAV2
pAAV2-BR1Insertion NRGTEWD at R588DEEndothelial cell1,000 -fold inscreaseAAV2
pAAV2-ESGHGYFinsertion ESGHGYF at R588DEpulmonary vasculature470-fold higher than in lungsAAV2
pAAV2g9Q464V、A467P、D469N、I470M、R471A、D472V、S474G、Y500F、S501ADECentral nervous systemsignificant enrichment of AAV2g9 genomes within the brainAAV2,AAV9
pAAV2-Kera2Insertion PRGDLAPDECutaneous2,500-fold increased cell entry efficiencyAAV2
pAAV ShH10I319V、N451D、D532N and H642NDERetinaa dramatic increase in specificity and efficiency for Müller cellsAAV6
pAAV2-retroinsert LADQDYTKTA + V708I + N382DDENeuronsMarkedly increased efficacy of retrograde access affordedAAV2
pAAV2-THGTPADinsert THGTPAD between 587 and 588DEHeart20-200 fold higerAAV2
pAAV2-NLPGSGDinsert NLPGSGD between 587 and 588DEHeart20-200 fold higerAAV2
pAAV3-STS663V+T492VDELiver~3-times, ~8-times, and ~80-times higher than for AAV9, AAV8, and AAV5AAV3
pAAV4.18-2K492E, K503E, N585SDECentral nervous system∼3- and 6-fold increasesAAV4
pAAV6.2F129LDEHuman ciliated airway epitheliumImproved transduction efficiencyAAV6
pAAV6.2FFF129L、Y445F、 Y731FDELung epithelial cellsEnhance transduction efficiencyAAV6
pAAV6Ddeletion of threonine at residue 265DEJoints2-fold higher transductionAAV6
pAAV6-TMY705 + 731F + T492VDEHematopoietic stem/progenitor cells~90% in HSPCs at significantly reduced vector dosesAAV6
pAAV9.452sub.LUNG1452-KDNTPGR-459DELung18-fold increased transductionAAV9
pAAV9-IKVinsertion GASIKVAVSAG between 588 and 589DERetina8.5-fold increased expressionAAV9
pAAV9-SLRSPPSSLRSPPS (AGCCTGCGGAGCCCACCTAGC)DEHuman aorta40-fold to AAV9-WTAAV9
pAAV9-RFTEKPARFTEKPA(CGTTTTACTGAGAAGCCTGCT)DEHuman aorta70-fold to AAV9-WTAAV9
pAAV-AMinserting a glycine residue at position 265 based on AAV-LK03 protein sequenceDELiver>100x increased transgene expressionAAV-LK03
pAAV-B1A24D、Q84K、A98V、L129F、P148Q、R152E、T157S、S223N、L235M、A268S、Q412E、T414S、T416Q、T452S、N458R、T461Q、G463L、G467A and F502SDECNS and muscle10.4- to 26.6-fold and 14.4-fold higher than AAV9 in transducing skeletal muscle and heartAAV8
pAAV-BBB612 aa differs from AAV1DECNS270-fold increased TEAAV1
pAAV-BBB2820 aa differs from AAV1DECNS270-fold increased TEAAV1
pAAV-BBB3122 aa differs from AAV1DECNS270-fold increased TEAAV1
pAAV-BI30insertion NNSTRGG between Q588 and A589DEEndothelial cell72- to 96-fold increased TEAAV9
pAAV-BI62Insertion PKNDGRW between Q588 and A589DECNSundisclosedAAV9
pAAV-BI65Insertion IRTGYAQ between Q588 and A589DECNSundisclosedAAV9
pAAV-DJ8RLADQDYTKTA inserted at N589-T590, N384D, TS710-711INDENeuronsMarkedly increasedAAVDJ8
pAAV-DJ-T251AT251ARDLiversignificant improvemenAAVDJ
pAAV-DJ-S503AS503ARDLiversignificant improvemenAAVDJ
pAAV-FFVVGQSY inserted at aa588/589DECNS65-fold (astrocytes) and 171-fold (neurons) higher than the parental AAV9AAV9
pAAV-SSTTLYSP inserted at aa588/589DECNSThe difference between AAVS and AAV9 was not significantAAV9
pAAV-Go.1UndisclosedDEPulmonaryhigher resistance than AAV-5 (100-fold)goat-derived adenovirus
pAAVHSC1A2T, R312QDEHuman stem cell-derived33.3-fold increased in titer than AAV9AAV9
pAAVHSC7A68VDEHuman stem cell-derived12-fold increased in titer than AAV9AAV9
pAAV-ieDGTLAVPFK inserted between N589 and R590DEinner ear cellsIncrease gene transfer efficiencyAAVDJ
pAAVM41UndisclosedDEMyocardium13-fold increasedAAV1、6、7 and 8
pAAV-MaCPNS1PHEGSSR insertion at aa Q588 and A589DEPeripheral nervous systems4-fold increased TEAAV9
pAAV-MaCPNS2PNASVNS insertion at aa Q588 and A589DEPeripheral nervous systems5.5-fold increased TEAAV9
pAAV-NP40UndisclosedDELiverdramatically improved functional human hepatocyte transductionAAV8
pAAV-NP59UndisclosedDELiverdramatically improved functional human hepatocyte transductionAAV8
pAAV-PHP.eCS587P588-RYKGDSV-A589Q590DECNSmarkedly increasedAAV9
pAAV.v1TALKPFL insertion between aa Q588 and A589DECNSundisclosedAAV9
pAAVpo.1UndisclosedDEMuscle, retinaundisclosedPig Tissues
pAAVpo2.1UndisclosedDEheart, kidney and muscleundisclosedPig Tissues
pAAV-PRPRPPSTH insertion at aa Q588 and A589DESmooth Muscle Cells6.7-fold higher TEAAV9
pAAV-SYD12UndisclosedDELiverundisclosedAAV7 and AAV8
pAAV-Rec2UndisclosedDERetinaundisclosedAAV8
pAAVrh32.33chimeric capsid of rh32 and rh33DEMuscleundisclosedAAV6、rh.48 and rh.37
pAAV-TTN312S, Q457M, S492A…DECNS13.4-fold increaseAAV2
pAAVv128Q588~A592→RGNQQNTARQDERetinal pigment epithelial64-fold increased TEAAV8
pAAV-X1GNNTRSV insertion between aa Q588 and A589DEbrain endothelial cells180-fold increased TEAAV9
pAAV-X1.1DGAATKN substitution at aa 452-458 site, GNNTRSV insertion at aa Q588 and A589DEbrain endothelial cells22% increased than AAVX1AA
pAnc80L6558 aa changedNDRetinaundisclosedAAV2 and AAV8
pArk313454-VVNPAEG-460DET lymphocytes30-fold increased TEAAV6
pBI-hTFR1YSRIGPN insertion between aa 588 and 589DECNS40 to 50 times greater reporter expressionAAV9
pCAP-B10I451-DGAATKN-Q459, S586-DGTLAVPFK-A587DEblood-brain barrierenhanced neuronal transduction 40- to 90-foldAAV9
pLICA1replace the AAV9 sequence of VR4
to VR8 with that of AAV-rh74 and remodeled 453-TDGRGDLGRLGP-464
DEMuscleundisclosedAAV9
pMNM004VMSVLLVDTDATQQ of AAV2 aa 587 and 588DEhuman dopamine neuronsundisclosedAAV2
pAAV1N/AN/AN/AN/ARhesus macaque
pAAV2N/AN/AN/AN/AHuman
pAAV3N/AN/AN/AN/AHuman
pAAV3BN/AN/AN/AN/AHuman
pAAV4N/AN/AN/AN/AGreen monkey
pAAV5N/AN/AN/AN/AHuman
pAAV6N/AN/AN/AN/AHuman
pAAV7N/AN/AN/AN/ARhesus macaque
pAAV8N/AN/AN/AN/ARhesus macaque
pAAV9N/AN/AN/AN/AHuman
pAAV10N/AN/AN/AN/ACynomologus macaque
pAAV11N/AN/AN/AN/ACynomologus macaque
pAAV12N/AN/AN/AN/AVervet monkey
pAAV13N/AN/AN/AN/AVervet monkey
pAAV bb.1N/AN/AN/AN/ABaboon
pAAV bb.2N/AN/AN/AN/ABaboon
pAAV ch.5N/AN/AN/AN/AChimpanzee
pAAV cy.2N/AN/AN/AN/ACynomologus macaque
pAAV cy.3N/AN/AN/AN/ACynomologus macaque
pAAV cy.4N/AN/AN/AN/ACynomologus macaque
pAAV cy.5N/AN/AN/AN/ACynomologus macaque
pAAV cy.6N/AN/AN/AN/ACynomologus macaque
pAAV hu.1N/AN/AN/AN/AHuman
pAAV hu.2N/AN/AN/AN/AHuman
pAAV hu.3N/AN/AN/AN/AHuman
pAAV hu.4N/AN/AN/AN/AHuman
pAAV hu.6N/AN/AN/AN/AHuman
pAAV hu.7N/AN/AN/AN/AHuman
pAAV hu.9N/AN/AN/AN/AHuman
pAAV hu.10N/AN/AN/AN/AHuman
pAAV hu.11N/AN/AN/AN/AHuman
pAAV hu.13N/AN/AN/AN/AHuman
pAAV hu.15N/AN/AN/AN/AHuman
pAAV hu.16N/AN/AN/AN/AHuman
pAAV hu.17N/AN/AN/AN/AHuman
pAAV hu.18N/AN/AN/AN/AHuman
pAAV hu.19N/AN/AN/AN/AHuman
pAAV hu.20N/AN/AN/AN/AHuman
pAAV hu.21N/AN/AN/AN/AHuman
pAAV hu.22N/AN/AN/AN/AHuman
pAAV hu.23N/AN/AN/AN/AHuman
pAAV hu.24N/AN/AN/AN/AHuman
pAAV hu.25N/AN/AN/AN/AHuman
pAAV hu.27N/AN/AN/AN/AHuman
pAAV hu.28N/AN/AN/AN/AHuman
pAAV hu.29N/AN/AN/AN/AHuman
pAAV hu.31N/AN/AN/AN/AHuman
pAAV hu.32N/AN/AN/AN/AHuman
pAAV hu.34N/AN/AN/AN/AHuman
pAAV hu.35N/AN/AN/AN/AHuman
pAAV hu.37N/AN/AN/AN/AHuman
pAAV hu.39N/AN/AN/AN/AHuman
pAAV hu.40N/AN/AN/AN/AHuman
pAAV hu.41N/AN/AN/AN/AHuman
pAAV hu.42N/AN/AN/AN/AHuman
pAAV hu.43N/AN/AN/AN/AHuman
pAAV hu.44N/AN/AN/AN/AHuman
pAAV hu.45N/AN/AN/AN/AHuman
pAAV hu.46N/AN/AN/AN/AHuman
pAAV hu.47N/AN/AN/AN/AHuman
pAAV hu.48N/AN/AN/AN/AHuman
pAAV hu.49N/AN/AN/AN/AHuman
pAAV hu.51N/AN/AN/AN/AHuman
pAAV hu.52N/AN/AN/AN/AHuman
pAAV hu.53N/AN/AN/AN/AHuman
pAAV hu.54N/AN/AN/AN/AHuman
pAAV hu.55N/AN/AN/AN/AHuman
pAAV hu.56N/AN/AN/AN/AHuman
pAAV hu.57N/AN/AN/AN/AHuman
pAAV hu.58N/AN/AN/AN/AHuman
pAAV hu.60N/AN/AN/AN/AHuman
pAAV hu.61N/AN/AN/AN/AHuman
pAAV hu.63N/AN/AN/AN/AHuman
pAAV hu.64N/AN/AN/AN/AHuman
pAAV hu.66N/AN/AN/AN/AHuman
pAAV hu.67N/AN/AN/AN/AHuman
pAAV hu.LG15N/AN/AN/AN/AHuman
pAAV hu.S17N/AN/AN/AN/AHuman
pAAV hu.T17N/AN/AN/AN/AHuman
pAAV hu.T32N/AN/AN/AN/AHuman
pAAV hu.T40N/AN/AN/AN/AHuman
pAAV hu.T41N/AN/AN/AN/AHuman
pAAV hu.T70N/AN/AN/AN/AHuman
pAAV hu.T71N/AN/AN/AN/AHuman
pAAV hu.T88N/AN/AN/AN/AHuman
pAAV pi.1N/AN/AN/AN/APig-tailed macaque
pAAV pi.2N/AN/AN/AN/APig-tailed macaque
pAAV pi.3N/AN/AN/AN/APig-tailed macaque
pAAV rh.1N/AN/AN/AN/ARhesus macaque
pAAV rh.2N/AN/AN/AN/ARhesus macaque
pAAV rh.8N/AN/AN/AN/ARhesus macaque
pAAV rh.12N/AN/AN/AN/ARhesus macaque
pAAV rh.13N/AN/AN/AN/ARhesus macaque
pAAV rh.14N/AN/AN/AN/ARhesus macaque
pAAV rh.16N/AN/AN/AN/ARhesus macaque
pAAV rh.17N/AN/AN/AN/ARhesus macaque
pAAV rh.18N/AN/AN/AN/ARhesus macaque
pAAV rh.19N/AN/AN/AN/ARhesus macaque
pAAV rh.22N/AN/AN/AN/ARhesus macaque
pAAV rh.24N/AN/AN/AN/ARhesus macaque
pAAV rh.25N/AN/AN/AN/ARhesus macaque
pAAV rh.32N/AN/AN/AN/ARhesus macaque
pAAV rh.33N/AN/AN/AN/ARhesus macaque
pAAV rh.34N/AN/AN/AN/ARhesus macaque
pAAV rh.35N/AN/AN/AN/ARhesus macaque
pAAV rh.36N/AN/AN/AN/ARhesus macaque
pAAV rh.37N/AN/AN/AN/ARhesus macaque
pAAV rh.38N/AN/AN/AN/ARhesus macaque
pAAV rh.39N/AN/AN/AN/ARhesus macaque
pAAV rh.40N/AN/AN/AN/ARhesus macaque
pAAV rh.43N/AN/AN/AN/ARhesus macaque
pAAV rh.46N/AN/AN/AN/ARhesus macaque
pAAV rh.48N/AN/AN/AN/ARhesus macaque
pAAV rh.49N/AN/AN/AN/ARhesus macaque
pAAV rh.50N/AN/AN/AN/ARhesus macaque
pAAV rh.51N/AN/AN/AN/ARhesus macaque
pAAV rh.52N/AN/AN/AN/ARhesus macaque
pAAV rh.53N/AN/AN/AN/ARhesus macaque
pAAV rh.54N/AN/AN/AN/ARhesus macaque
pAAV rh.55N/AN/AN/AN/ARhesus macaque
pAAV rh.57N/AN/AN/AN/ARhesus macaque
pAAV rh.58N/AN/AN/AN/ARhesus macaque
pAAV rh.60N/AN/AN/AN/ARhesus macaque
pAAV rh.61N/AN/AN/AN/ARhesus macaque
pAAV rh.62N/AN/AN/AN/ARhesus macaque
pAAV rh.64N/AN/AN/AN/ARhesus macaque
pAAV VR-195N/AN/AN/AN/ACynomolgus macaque
pAAV VR-335N/AN/AN/AN/ARhesus macaque
pAAV-BI48TPQRPFI insertion between aa Q588 and A589RDCNSenhanced CNS tropismAAV9
pAAV P2-V1multiplex of substitutions, S264A, A493G, and N551DRDRetina2-fold increase in the fluorescent signal intensityAAV2
pAAV Pep2hSC1584Q-GQRKRGDSWSE-A590DEHuman Schwann cells4.6-fold improved TEAAV2
pAAV Pep2hSC2584Q-GQRRKDVDFDK-A590DEHuman Schwann cells1.4-fold improved TEAAV2
pAAV ShH10YI319V、N451D、D532N、H642N、Y445FDEMüller glial cellsundisclosedAAV6
pAAV A46-RGD4Cinserting RGD-4C peptide(CDCRGDCFC) at position 588RDheparan sulfate proteoglycan40-fold higher on the K562 cells, 13-fold higher on the Raji cells, and 6-fold higher on the SKOV-3 cells, than gene transfer mediated by particles with wild-type capsidsAAV2
pAAV2 520inserting RGD-4C peptide(CDCRGDCFC) at position 520RDheparan sulfate proteoglycanundisclosedAAV2
pAAV2 584inserting RGD-4C peptide(CDCRGDCFC) at position 584RDheparan sulfate proteoglycanundisclosedAAV2
pAAV 1.9-3Engineered AAV1 capsid with amino acids 445–568 being replaced with those of AAV9DEhuman dermal fibroblasts5.2-fold higher transgene expressionAAV1
pAAV1 RGDD590-AS-CDCRGDCFC-ALS-P591ATGDVHAM599DEVascular endothelial cells50–100-fold enhancementAAV1
pAAV R484E, R585ER484E, R585EDEHeartundisclosedAAV2
pAAV2(4pMut)ΔHSY444F、Y500F、Y730F、T491V、R585S、R588T、R487GDERetinaundisclosedAAV2
pAAV.CPP.21R588 TVSALFK Q589RDIntravitrealsignificant increaseAAV2
pAAV2-588NGRInsertion NGR at position 588DECD1310-to 20-fold better than WTAAV2
pAAV2-C4Insertion PRGTNGP at position 587DEMelanoma3.2-fold increased specificityAAV2
pAAV2-D10insertion SRGATTT at position 587DEMelanoma3.7-fold increased specificityAAV2
pAAV2-CNHinsertion CNHRYMQMC at position 587DEPlaque100-fold increased TEAAV2
pAAV2-CAPinsertion CAPGPSKSC at position 587DEPlaque10-fold increased TEAAV2
pAAV2-EYHinsertion EYHHYNK at position 587DEPrimary human arterial SMC70-fold increased TEAAV2
pAAV2-GMNinsertion GMNAFRA at I-587DEBrain vasculature70% increased TEAAV2
pAAV2-HBKOR585A, R588ADECNSundisclosedAAV2
pAAV2-K490EK490EDELiver5-10 fold increased TEAAV2
pAAV2-K544EK544EDELiver5-10 fold increased TEAAV2
pAAV2-K549EK549EDELiver5-10 fold increased TEAAV2
pAAV2-K556EK556EDELiver5-10 fold increased TEAAV2
pAAV2-LiAQ263A, Y444F, 449N-SEGGSLTQSSLGF-S463, 491T-TDGENNNSDF-Y500RD+DELiver20 fold increased TEAAV2
pAAV2-LiCQ263A, Y500F, T503P,K507TRD+DELiver20 fold increased TEAAV2
pAAV2-MO7ARGDAVGV insertion between 587 and 588DELiver100-fold increased efficiencyAAV2
pAAV2-MecAGENQARS insertion between 587 and 588DELiver100-fold increased efficiencyAAV2
pAAV2-MTPMTPFPTSNEANL insertion between 587 and 588DEvascular tissue400-fold increased efficiencyAAV2
pAAV2-PFGAAAWPFYGTPAA insertion between 587 and 588DEBrain35-fold higherAAV2
pAAV2-PSVSPRPPSVSPRP insertion between 587 and 588DEcardiac tissue100-fold higherAAV2
pAAV2-PTP585TRKTLLPTPTS595DEPlectin-124-fold higherAAV2
pAAV2-QPEQPEHSST insertion between 587 and 588DEvascular endothelium33-fold increaseAAV2
pAAV2-VNTVNTANST insertion between 587 and 588DEvascular endothelium11-fold increaseAAV2
pAAV2-QuadYF+TVY272F、Y444F、Y500F、Y730F、T491VDEvascular endothelial cellsundisclosedAAV2
pAAV2-SIGInsertion SIGYPLP between 587 and 588DEHuman Vascular Endothelial Cells5.9-fold for
HUVEC and 28.2-fold for HSVEC
AAV2
pAAV2-VTAGRAPVTAGRAP insertion at 588DECalu 610-fold increasedAAV2
pAAV3B.STS663V+T492VDEhuman liver cancer cells and primary human hepatocytes2-10-fold increasedAAV3B
pAAV3B-DE524 aa substitutionsDELiver2-10-fold increasedAAV3B
pAAV8-1-15N665QDELiver, retinaundisclosedAAV8
pAAV6-RGD-Y705-731F+T492V+K531EAAV6-RGD-Y705-731F+T492V+K531EDELiver8-fold increasedAAV6-RGD
pAAV6-S663V+T492VS663V+T492VDEdendritic cells5-fold increasedAAV6
pAAV6tYFY445, 705 and 731FDEhematopoietic stem cellsundisclosedAAV6
pAAV6-Y445FY445FDESkeletal Muscle8-fold increasedAAV6
pAAV8 (dYF + T–V)Y447 + 733F + T494VDEneonatal10-30 fold increasedAAV8
pAAV8.N271DN271DDEliver>100-foldAAV8
pAAV9.N270DN270DDEliver363-foldAAV9
pAAV8-2-ESGLSQSQ587G588Q589R590-G-ESGLSQS-AQAAQ594DELung, kidney, brainlung (3.42-fold), kidney (9.88-fold), brain (9.08-fold)AAV8
pAAV8-Y447+Y733Y447+Y733FDEPancreatic tissues7-14-fold increasedAAV8
pAAV9P31WPTSYDA insertion between aa 588 and 589DEBrainundisclosedAAV9
pAAV9-RetroLADQDYTKTA insertion between aa 588 and 589DEneonatalundisclosedAAV9
pAAV-Se1A587G, Q588-AGNGVRSVG-589A, insert A at position 591DEneonatal3-fold increasedAAV9
pAAV-Se2A587G, Q588-AGPGVPGRF-589A, insert A at position 591DEneonatal8-fold increasedAAV9
pAAV9-SLRSPPSA587G-Q588, Insert AG-SLRSPPS-A Q590 A591 A592DEendothelial cellundisclosedAAV9
pAAV9-RGDLRVSA587G-Q588, Insert AG-RGDLRVS -A Q590 A591 A592DEendothelial cellundisclosedAAV9
pAAV13-YFY443F, Y728FDEneonatalundisclosedAAV13
pAAV13-585-7m8LALGETTRPA inserted after positions 585DEneonatalundisclosedAAV13
pAAV44.9T179S、S473N、S483C and E531DDEacinar cells150-fold higher than AAV2AAVrh.8
pAAV44.9(E531D)E531DDERetinaundisclosedAAV44.9
pAAV-DB-37-mer aa insertion at position 590DEDeep brain and cortical structuresundisclosedAAV1
pAAV-ΔIV-NGRQ584S,NGRAHA insertion at position 588DEKaposi sarcoma cells10-20 foldAAV2
pAAV-DJ-S269TS269TDELiver~3-fold increased TEAAV-DJ
pAAV-LK03-Y705+731FY705+731FDELiver10-fold increased TEAAV-LK03
pAAV.S2DGAATKQ substitution at 451DEBrain2.31 ± 0.37-fold higher expressionAAVrh.10
pAAV1-T593KT593KDENeurons14- and five-fold increaseAAV1
pAAV3B-V04450-SNASGTAGTRGLM-462DEHepatocyte20-fold increasedAAV3B
pAAV5-PK2574-QSKKSTT-578DELiver62-fold increasedAAV5
pAAV8 BP2P585-ABNNNPNPDERetinaundisclosedAAV8
pAAV8RL586Q587-insert RGNLADQDYTKTARQAATAD, N385DDEstriatal D1mediumspiny neuronsundisclosedAAV8
pAAV8R12L586Q587-insert RGNLADQDYTKTARQAATAD, N385D, V183E, N411SDEstriatal D1mediumspiny neuronsundisclosedAAV8
pAAVDJK2AAAPRGDLAPAA insertion between 589 and 590DEkeratinocytes2-fold increased TEAAVDJ
pAAV-ie-K558RK558RDEcochlearundisclosedpAAV.ie
pAAV-LK03-REDHD598H, R594ERDLiverundisclosedAAV-LK03
pAAV variant 5.3AAV12 VP1/2 AND AAV6 VP3RDCNS100-fold higher MOI of wild-type AAV6 vectorsAAV12 VP1/2 AND AAV6 VP3
pAAVzk2FAPTPGP insertion after Q574DELiver4-11 fold higerAAV5
pBAP-AAV1D590_P591insBAP(TGGLNDIFEAQKIEWHEGLS)RDNeuronsundisclosedAAV1
pChimeric-1829[暂未找到]DEmelanoma3-5 fold higher expressionAAV9
pDMD4QVSHWVSGLAEGSFG insertion between 587 and 588DEHER-2undisclosedAAV2
peAAV9LSLEEEWAQVECEVYGRG
CPSGSLDESFYDWFERQLGAG insertion between aa 589 and 590
DEMuscle18-fold increasedAAV9
pHAE-2[暂时空置]DEHuman
Ciliated Airway Epithelium
[暂时空置][暂时空置]
pAAV.IVT18After aa 587DERetina[暂时空置]AAV2
pAAV LP2-10E531K, R725H, N735PDELiverhiger TDAAV serotypes 2, 6, 8,
and 9
pAAV MDV1AA587Q588-RSVGSVY-A596DECNS2-3 fold increaseAAV9
pAAV MDV1BA587Q588-KTVGTVY-A596DECNS2-3 fold increaseAAV9
pAAV9-PAL2Q585-EVGPTQGTVRDECNS4-6-fold increaseAAV9
pAAV MG1.1A587L-MTPPKTT, Q588SDEmicrogliaundisclosedAAV9
pAAV MG1.2A587-TEPPKTT, Q588SDEmicrogliaundisclosedAAV9
pAAV MV50G257R, S705GDELiver10-fold increased TEAAV5
pAAV MV53Q179R, G257RDELiver10-fold increased TEAAV5
pAAV NHP#9583~LALIQDSMRADERetina12-fold increaseAAV2
pAAV NHP#26~583-LQRGVRIPSVLEVNGQDERetinaundisclosedAAV2
pAAV RC-C02587‑LALGETTRPA‑588, I240T‑V708IDERetinaundisclosedAAV2
pAAV RC-C14587‑LALGDVTRPA,I240T‑V708IDERetinaundisclosedAAV2
pAAV Rec2.V7F503Y/Y708D/K709IDEAdipose4.5-fold increaseREC2
pAAV RhAAV4282Multilocus mutationDETissueundisclosedAAV7
pAAV rRGD453koG453-ACDCRGDCDFCATTT, R585A,R588ADEhuman cervix epitheloid cell~40-fold increaseAAV2
pAAV v8-1-15N665QRDhepatocyteundisclosedAAV8
pAAV vS3-1-2T451NRDhepatocyteundisclosedAAVS3
pAAV VCAP-102G453-ins HDSPHKSGDECNS20- to 400-fold increasedAAV9
pAAV Vivec-N002GNYRGNP(gggaattataggggtaatccg) insertion between Q588 and A589DECNSundisclosedAAV9
pAAV XL32.1Multilocus mutationDECNSundisclosedAAV2
pAAV RC-V25RQGVPTQPG insertion between 578 and 588DERetinaundisclosedAAV2
pAAVYC5S424G、S456G and S468GDERetina2.8–4 folds higherAAVXL32
pAAV-T1SEAVEGKEKDET cells5-fold increased TEAAV6
pAAV-T2SEAVEGKEKDET cells5-fold increased TEAAV6
pAAV-DJ-N589XN589X(TAG)DEFibroblasts5-15 fold increased TEAAV-DJ
pAAV-cMGchanges on AAV9 capsid: K449R, A589D; insertion of QRPPRPA between Q588 and D589DEmicrogliaundisclosedAAV9
pAAV.CAP-B227 amino acid substitution between VP1 452 and VP1 460 from NGSGQNQ to DGQSSKSDEBrainundisclosedAAV-PHP.eB
pAAV-PHP.V1AQ588-TALKPFL-A589QDECNSundisclosedAAV9
pSR646 modified AAV-2 rep78, modified AAV-6 capNANAundisclosedAAV6
pAAV-cMG.WPPchanges on AAV9 capsid: K449R; insertion of WPPKTTS between Q588 and A589DEmicrogliaundisclosedAAV9
pAAV-cMG.QRPchanges on AAV9 capsid: K449R; insertion of QRPPREP between Q588 and A589DEmicrogliaundisclosedAAV9
pAAV.FUS.3AAV9 modified with 7-amino acid insertion between AA position 588 and 589 of VP1DECNS10-fold increased TEAAV9
pAAV-BI-hTFR1-4AAV9 modified with YHRLSNN insertion between AA position 588 and 589 of VP1DECNS40 to 50 times greater than AAV9AAV9
pAAV-BI-hTFR1-3AAV9 modified with YSRLNKD insertion between AA position 588 and 589 of VP1DECNS40 to 50 times greater than AAV9AAV9
pAAV-BI-hTFR1-2AAV9 modified with YSRLNMN insertion between AA position 588 and 589 of VP1DECNS40 to 50 times greater than AAV9AAV9
pAAV.cc84-mut7 amino acid substitution between VP1 586 and VP1 592 from SAQAQAQ to NAVGALSDEBrain ECsundisclosedAAV9
pAAV-M.Fas.47 amino acid(VVSDYTV) insertion between vp1 588 and vp1 589DECNSundisclosedAAV9
pAAV-M.Fas.37 amino acid(RVDPSGL) insertion between vp1 588 and vp1 589DECNSundisclosedAAV9
pAAV-M.Fas.27 amino acid(STIPTMK) insertion between vp1 588 and vp1 589DECNSundisclosedAAV9
pAAV-M.Fas.17 amino acid(TDALTTK) insertion between vp1 588 and vp1 589DECNSundisclosedAAV9
pAAV-PAL1DPTQGTFR insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV-PAL1CPTQGTLR insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV-PAL1BPSQGTLR insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV-PAL1APTQGTVR insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV-M.Mus.2REQQKLW insert between amino acids 588 and 589 of AAV9 VP1, A587D, Q588GDECNSundisclosedAAV9
pAAV-M.Mus.1WVLPSGG insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV-PHP.AXS586-DGTLAVPFK-A589DECNSundisclosedAAV9
piCAP-ROOTIPNMGDH insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV-S in pAR9STTLYSP insert between amino acids 588 and 589 of AAV9 VP1DECNSundisclosedAAV9
pAAV2-N587XN589X(TAG)DEFibroblasts5-15 fold increasedAAV2
pAAV2_586_PLGLARG586-AGPLGLARGDDDDGPLGLARGA-N587DEmetastatic epithelial ovarian cancerundisclosedAAV2
pAAV PHP.B4TLQIPFK insert between amino acids 588 and 589 of AAV9 VP1DEbrain vascular cellsundisclosedAAV9
pAAV PHP.B3FTLTTPK insert between amino acids 588 and 589 of AAV9 VP1DEbrain vascular cellsundisclosedAAV9
pAAV PHP.B2SVSKPFL insert between amino acids 588 and 589 of AAV9 VP1DEbrain vascular cellsundisclosedAAV9
pAAV PHP.v2TTLKPFL insert between amino acids 588 and 589 of AAV9 VP1DEbrain vascular cellsundisclosedAAV9
pAAV‑PM166TDGNLANPFK subsititution from aa 586 to aa588DEbrain vascular cellsundisclosedAAV9
pAAV‑PM167SEGTLAQPFK subsititution from aa 586 to aa588DEbrain vascular cellsundisclosedAAV9
pAAV‑PM170SAGTIAQPFK subsititution from aa 586 to aa588DEbrain vascular cellsundisclosedAAV9
pAAV‑PM171QAGTLQQPFK subsititution from aa 586 to aa588deep learningbrain vascular cellsundisclosedAAV9
pAAV MLIV.KAAAKGGALGGAA insert between amino acids 587 and 588 of AAV2 VP1DELiver14-16-fold higherAAV2
pAAV MLIV.AAAAASTGPHTAA insert between amino acids 587 and 588 of AAV2 VP1DELiver5-6-fold higherAAV2
pAAV2.5AAV2 to AAV1, Q263A, T265 (insertion), N706A, V709A, and T717N,DEantibody escape phenotypeundisclosedAAV2
pAAV-Ep+ERDRTRG insertion at 590DEkey brain tissues22.05-fold increase in TEAAV1
pAAV M6Q588-AMPRTPG-A589DEblood–brain barrier5 times higher titer than AAV-PHP.EbAAV9
pAAV M8Q588-TMPRHPP-A589DEblood–brain barrier3 times higher titer than AAV-PHP.EbAAV9
pAAV2-LSSLPSSLQK insertion between N587 and R588DECNSmarkedly improved brain tropismAAV2
pAAV2-PPSDSPAHPS insertion between N587 and R588DECNSmarkedly improved brain tropismAAV2
pAAV2-TLHGWTLHNK insertion between N587 and R588DECNSmarkedly improved brain tropismAAV2
pAAV2-DMD6LSHTSGRVEGSVSLL insertion between N587 and R588DEvaccineundisclosedAAV2
pAAV-APVTRPAN587Q, APVTRPA insertion behind R588DEtumor cellsundisclosedAAV2
pAAV-DLSNLTRN587Q , DLSNLTR insertion behind R588DEtumor cellsundisclosedAAV2
pAAV-NQVGSWSN587Q , NQVGSWS insertion behind R588DEleukemia cellup to 500-fold better
transduction efficiency
AAV2
pAAV-EARVRPPN587Q , EARVRPP insertion behind R588DEtumor cellsup to 36-fold increase in CML transduction efficiencyAAV2
pAAV-NSVSLYTN587Q , NSVSLYT insertion behind R588DEtumor cells (CML)up to 36-fold increase in CML transduction efficiencyAAV2
pAAV-LS1N587Q , NDVRSAN insertion behind R588DEtumor cells (CML), CD34+ cellsup to eightfold
higher than AAV2
AAV2
pAAV-LS2N587Q , NESRVLS insertion behind R588DEtumor cells (CML), CD34+ cellsup to eightfold
higher than AAV2
AAV2
pAAV-LS3N587Q , NRTWEQQ insertion behind R588DEtumor cells (CML), CD34+ cellsup to eightfold
higher than AAV2
AAV2
pAAV-LS4N587Q , NSVQSSW insertion behind R588DEtumor cells (CML), CD34+ cellsup to eightfold
higher than AAV2
AAV2
pAAV-RGDLGLSN587Q, RGDLGLS insertion behind R588DEtumor cells3.5~17.8 fold higherAAV2
pAAV-RGDMSREN587Q, RGDMSRE insertion behind R588DEtumor cells3.5~17.8 fold higherAAV2
pAAV-EYRDSSGN587Q, EYRDSSG insertion behind R588DEtumor cells3.5~17.8 fold higherAAV2
pAAV-DLGSARAN587Q, DLGSARA insertion behind R588DEtumor cells3.5~17.8 fold higherAAV2
pAAV-GPQGKNSN587Q, GPQGKNS insertion behind R588DEtumor cellsAAV2
pAAV-NSSRDLGN587Q, NSSRDLG insertion behind R589DEtumor cellsundisclosedAAV2
pAAV-PT1TEN to EKH at 376-378 in VR-III, S518K in VR-VI, and ND to SE at 694-695, Q697T and T706A in VR-IXDERetinaundisclosedAAV5
pAAV.eMdeleting residues 585–587,R585A, S585-NSRGDYNSLR-Q596DEMuscleundisclosedAAV9
pAAVC7Multilocus mutationDECardiotropismundisclosedAAV9
pAAV-hCA4-IV77insertion of STQFRGM between amino acids 588 and 589 of AAV9 VP1DEBrain100-fold greater brain transductionAAV9
pAAV BRC06GSPTFYS replace of 587 AQAQ 590DECNS1,482-fold brain enhancement with a 92-fold liver reduction relative to AAV9.AAV9
pAAV MC5insertion IRENAQP after aa588DEMicroglia3.74-fold enrichmentAAV9

AE,antibody evasion; DE, directed evolution; GalNAc, N-acetylgalactosamine; ND, natural discovery; RD, rational design; SP, specificity; TE, transduction efficiency.

Scroll to Top