Sequence and Plasmid Archive
Adeno-associated virus (AAV) has emerged as a highly promising vector for human gene therapy due to its favorable safety profile, versatility, and ability to transduce a wide range of tissues. However, natural AAV serotypes have shortcomings, including suboptimal transduction efficiency, pre-existing immunity, and a lack of tissue specificity, that hinder their therapeutic potential. To address these challenges, significant efforts are being applied to engineer novel AAV capsids.
The following table contain a list of RepCap plasmid (encoding AAV Rep and respective capsid protein which determines the AAV serotype) that are useful to produce natural or engineered novel AAV. You can search or sort this table based on plasmid name, species, gene name and order the RepCap plasmid immediately.
Check out our Pre-made AAV and learn about our options for hundreds of in-stock preps that are ready to ship right away, as well as our AAV Production Service to give you more flexibility.
| Name | Mutations | Engineering strategy | Tropism | Fold improvement | Parental serotype |
|---|---|---|---|---|---|
| pAAV9.HR | H527Y,R533S | RD | CNS | 200-fold decreased liver TE | AAV9 |
| pAAVhum.8 | mutations in VR-IV, VR-V, VR- | RD | liver | 10-fold increase TE | AAV8 |
| pAAV.CPP.16 | TVSALK insertion at 588/589 | RD | CNS | 1.9-fold increase TE | AAV9 |
| pAAV r2.15 | E12A, K258N,N5871 T716A,T567S | DE | liver, muscle, | 96-fold increased AE | AAV2 |
| pAAV SCH9 | 58 total mutations; 92% identity | DE | NSCs, | 12-fold increased TE | AAV9 |
| pAAV 2.7m8 | LALGETTRP insertion at position | DE | retina | 5-fold increased TE | AAV2 |
| pAAV R100 | 10 amino acid peptide insertion at | DE | retina | 2.6-3.75-fold increased TE | AAV2 |
| pMyoAAV2A | 10-mer insert at hypervariable region VIII | DE | skeletal | 128-fold increased TE | AAV9 |
| pAAV-KP1 | chimeric capsid from multiple | DE | pancreatic | 5-10-fold increased TE | chimeric |
| pAAV V66 | K39Q, V151A,R447K, T450A, | ND | CNS | ~13-fold increased TE | AAV2 |
| pAAV-PHP.eB | 7-mer insertion (TLAVPFK) | DE | neurons | 1.5- to 4-fold increased TE | AAV9 |
| pAAV Cap.Mac | 21-bp insertion after Q588 in AAV9 | DE | neurons | 45-fold increased TE | AAV9 |
| pAAV.K20 | VSGRREG substitution at position | DE | kidney | 9-fold increased expression | AAV9 |
| pAAV-Spark100 | Derived from AAVrh74 | DE/RD | liver | 8-12 increased SP | AAVrh74 |
| pAAV A101 | chimera reconstruction from AAV1, AAV2, AAV4, AAV6 and AAV9 | DE | lung | 32-fold increased AE, 4-fold increased TE | chimeric |
| pAAV2tYF | three tyrosine-to-phenylalanine (YF) mutations in AAV2 capsid | RD | retina | >30-fold increased TE in ganglion cells | AAV2 |
| pAAV Anc80 | ancestral sequence reconstruction | RD | retina | ~1.77- to 4.5-fold higher TE | chimeric |
| pAAV LK03 | capsid shuffled | DE | liver | 1.96-fold increased TE | chi meric |
| pAAV rh.10 | Rep2/Cap-rh10 | DE | neurons | 1- to 14-fold higher gene delivery | Rhesus macaque |
| pAAV Olig001 | Olig001 capsid gene / rep 2 | DE | Central Nervous System | 9-fold greater binding | contains a chimeric mixture of AAV1, 2, 6, 8 and 9 |
| pAAV S3 | preferentially targets the human liver | RD | Gaucher | 10-fold increased gene delivery | AAV8,AAV5 |
| pAAV 4D-C102 | LANKTTNKDA insertion at position 588 of AAV2, V708 mutation | DE | Cardiac and Skeletal Muscle | 12-fold increased expression | AAV2 |
| pAAV DJ | 262 NSTSGGSSN 270 | DE | Liver | 9-10-Fold increased TE | AAV-2/8/9 |
| pAAV 2.5T | a chimera between AAV2 (aa1–128) and AAV5 (aa129–725) with one point mutation (A581T) | DE | Human airway epithelium | 100-fold increased gene transfer | AAV2,AAV5 |
| pAAV 2i8G9 | 585-NLQQQN-590 and Q464V, A467P,D469N, I470M, R471A, D472V, S474G, Y500F, and S501A were mutated | RD | Muscle | 200-fold decreased than AAV9 in liver | AAV2 |
| pAAV 2i8 | 585-NLQQQN-590 | RD | Muscle | 10-fold increased tenfold increases in transduction efficiency | AAV2 |
| pAAV 9.45 | N498Y,L602F | DE | Cardiac and musculoskeletal | 10-25 fold decrease in liver | AAV9 |
| pAAV 9.61 | N498I | DE | Cardiac and musculoskeletal | 10-25 fold decrease in liver | AAV9 |
| pAAV BL154 | 7 aa(TGRVDSR) insertion after Q588 in AAV9 cap | machine learning | Liver transduction | 1000-fold increased TE | AAV9 |
| pAAV HRH | Y446H、N470R 、W503H | DE | Cardiac | 6-fold reduction in liver RNA expression and a 10-fold increase in cardiac RNA expression | AAV9 |
| pMyoAAV 1A | RGDLTTP insertion betweem 588 and 589 | DE | Muscle fibers and cardiomyocytes | 14-fold higher EGFP mRNA expression | AAV9 |
| pMyoAAV 4A | SNSRGDYNSL insertion betweem 585 and 586 | DE | Muscle | transduced human primary myotubes with particularly high efficiency | AAV9 |
| pAAV MYO | RGDLGLS insertion at 599 | DE | Muscle | 61-, 17-, or 11-fold increases in the diaphragm, quadriceps femoris, or heart, respectively. | AAV9 |
| pAAV r3.45 | insertion of LATQVGQKTA (LA and A are linker residues) at aa587 with an V719M mutation | DE | Neural stem cells | 14.4-50-fold increase in infection | AAV2 |
| pAAV TR2 | 7-mer peptide(RTTASLM) inserts between amino acids 588 and 589 of VP1 | DE | spinal cord | 8-fold increase | AAV9 |
| pAAV.cc47 | 452-GVSLGGG-458 | DE | heart, tibialis anterior, and brain | 21-, 16-, and 2-fold higher fluorescence intensity in the heart, tibialis anterior, and liver | AAV9 |
| pAAV.GT5 | S472A、S587A、 N706A | DE | liver | 50-fold higher TE | AAV3B |
| pAAV.k13 | 452-MVEGRMG-458 | DE | kidney | 40-fold increased TE | AAV9 |
| pAAV.KK04 | A264, T266 etc. | DE | cardiomyocytes | rAAV.KK04 was the best-performing vector in human-based screening platforms | AAV3 |
| pAAV1P4 | Insert NDVRSAN after aa588 | DE | fibers | 100-fold increased TE | AAV1 |
| pAAV2.A1 | T456I,delete R459 | DE | central nervous system | 10–15 times higher than that of AAV2 | AAV2 |
| pAAV2.A2 | R447M, T456S | DE | central nervous system | 10–15 times higher than that of AAV2 | AAV2 |
| pAAV2.GL | Insertion GLSPPTR between N587 and R588 | DE | Retina | 13.4-fold increase in transcription | AAV2 |
| pAAV2.NN | Insertion NNPTPSR between N587 and R588 | DE | Retina | 12.1-fold increase in transcription | AAV2 |
| pAAV2.MB453 | Insertion RDVLPGT | DE | Liver | Significantly reduced CD8+ T cell responses against the transgene product | AAV2 |
| pAAV2-BR1 | Insertion NRGTEWD at R588 | DE | Endothelial cell | 1,000 -fold inscrease | AAV2 |
| pAAV2-ESGHGYF | insertion ESGHGYF at R588 | DE | pulmonary vasculature | 470-fold higher than in lungs | AAV2 |
| pAAV2g9 | Q464V、A467P、D469N、I470M、R471A、D472V、S474G、Y500F、S501A | DE | Central nervous system | significant enrichment of AAV2g9 genomes within the brain | AAV2,AAV9 |
| pAAV2-Kera2 | Insertion PRGDLAP | DE | Cutaneous | 2,500-fold increased cell entry efficiency | AAV2 |
| pAAV ShH10 | I319V、N451D、D532N and H642N | DE | Retina | a dramatic increase in specificity and efficiency for Müller cells | AAV6 |
| pAAV2-retro | insert LADQDYTKTA + V708I + N382D | DE | Neurons | Markedly increased efficacy of retrograde access afforded | AAV2 |
| pAAV2-THGTPAD | insert THGTPAD between 587 and 588 | DE | Heart | 20-200 fold higer | AAV2 |
| pAAV2-NLPGSGD | insert NLPGSGD between 587 and 588 | DE | Heart | 20-200 fold higer | AAV2 |
| pAAV3-ST | S663V+T492V | DE | Liver | ~3-times, ~8-times, and ~80-times higher than for AAV9, AAV8, and AAV5 | AAV3 |
| pAAV4.18-2 | K492E, K503E, N585S | DE | Central nervous system | ∼3- and 6-fold increases | AAV4 |
| pAAV6.2 | F129L | DE | Human ciliated airway epithelium | Improved transduction efficiency | AAV6 |
| pAAV6.2FF | F129L、Y445F、 Y731F | DE | Lung epithelial cells | Enhance transduction efficiency | AAV6 |
| pAAV6D | deletion of threonine at residue 265 | DE | Joints | 2-fold higher transduction | AAV6 |
| pAAV6-TM | Y705 + 731F + T492V | DE | Hematopoietic stem/progenitor cells | ~90% in HSPCs at significantly reduced vector doses | AAV6 |
| pAAV9.452sub.LUNG1 | 452-KDNTPGR-459 | DE | Lung | 18-fold increased transduction | AAV9 |
| pAAV9-IKV | insertion GASIKVAVSAG between 588 and 589 | DE | Retina | 8.5-fold increased expression | AAV9 |
| pAAV9-SLRSPPS | SLRSPPS (AGCCTGCGGAGCCCACCTAGC) | DE | Human aorta | 40-fold to AAV9-WT | AAV9 |
| pAAV9-RFTEKPA | RFTEKPA(CGTTTTACTGAGAAGCCTGCT) | DE | Human aorta | 70-fold to AAV9-WT | AAV9 |
| pAAV-AM | inserting a glycine residue at position 265 based on AAV-LK03 protein sequence | DE | Liver | >100x increased transgene expression | AAV-LK03 |
| pAAV-B1 | A24D、Q84K、A98V、L129F、P148Q、R152E、T157S、S223N、L235M、A268S、Q412E、T414S、T416Q、T452S、N458R、T461Q、G463L、G467A and F502S | DE | CNS and muscle | 10.4- to 26.6-fold and 14.4-fold higher than AAV9 in transducing skeletal muscle and heart | AAV8 |
| pAAV-BBB6 | 12 aa differs from AAV1 | DE | CNS | 270-fold increased TE | AAV1 |
| pAAV-BBB28 | 20 aa differs from AAV1 | DE | CNS | 270-fold increased TE | AAV1 |
| pAAV-BBB31 | 22 aa differs from AAV1 | DE | CNS | 270-fold increased TE | AAV1 |
| pAAV-BI30 | insertion NNSTRGG between Q588 and A589 | DE | Endothelial cell | 72- to 96-fold increased TE | AAV9 |
| pAAV-BI62 | Insertion PKNDGRW between Q588 and A589 | DE | CNS | undisclosed | AAV9 |
| pAAV-BI65 | Insertion IRTGYAQ between Q588 and A589 | DE | CNS | undisclosed | AAV9 |
| pAAV-DJ8R | LADQDYTKTA inserted at N589-T590, N384D, TS710-711IN | DE | Neurons | Markedly increased | AAVDJ8 |
| pAAV-DJ-T251A | T251A | RD | Liver | significant improvemen | AAVDJ |
| pAAV-DJ-S503A | S503A | RD | Liver | significant improvemen | AAVDJ |
| pAAV-F | FVVGQSY inserted at aa588/589 | DE | CNS | 65-fold (astrocytes) and 171-fold (neurons) higher than the parental AAV9 | AAV9 |
| pAAV-S | STTLYSP inserted at aa588/589 | DE | CNS | The difference between AAVS and AAV9 was not significant | AAV9 |
| pAAV-Go.1 | Undisclosed | DE | Pulmonary | higher resistance than AAV-5 (100-fold) | goat-derived adenovirus |
| pAAVHSC1 | A2T, R312Q | DE | Human stem cell-derived | 33.3-fold increased in titer than AAV9 | AAV9 |
| pAAVHSC7 | A68V | DE | Human stem cell-derived | 12-fold increased in titer than AAV9 | AAV9 |
| pAAV-ie | DGTLAVPFK inserted between N589 and R590 | DE | inner ear cells | Increase gene transfer efficiency | AAVDJ |
| pAAVM41 | Undisclosed | DE | Myocardium | 13-fold increased | AAV1、6、7 and 8 |
| pAAV-MaCPNS1 | PHEGSSR insertion at aa Q588 and A589 | DE | Peripheral nervous systems | 4-fold increased TE | AAV9 |
| pAAV-MaCPNS2 | PNASVNS insertion at aa Q588 and A589 | DE | Peripheral nervous systems | 5.5-fold increased TE | AAV9 |
| pAAV-NP40 | Undisclosed | DE | Liver | dramatically improved functional human hepatocyte transduction | AAV8 |
| pAAV-NP59 | Undisclosed | DE | Liver | dramatically improved functional human hepatocyte transduction | AAV8 |
| pAAV-PHP.eC | S587P588-RYKGDSV-A589Q590 | DE | CNS | markedly increased | AAV9 |
| pAAV.v1 | TALKPFL insertion between aa Q588 and A589 | DE | CNS | undisclosed | AAV9 |
| pAAVpo.1 | Undisclosed | DE | Muscle, retina | undisclosed | Pig Tissues |
| pAAVpo2.1 | Undisclosed | DE | heart, kidney and muscle | undisclosed | Pig Tissues |
| pAAV-PR | PRPPSTH insertion at aa Q588 and A589 | DE | Smooth Muscle Cells | 6.7-fold higher TE | AAV9 |
| pAAV-SYD12 | Undisclosed | DE | Liver | undisclosed | AAV7 and AAV8 |
| pAAV-Rec2 | Undisclosed | DE | Retina | undisclosed | AAV8 |
| pAAVrh32.33 | chimeric capsid of rh32 and rh33 | DE | Muscle | undisclosed | AAV6、rh.48 and rh.37 |
| pAAV-TT | N312S, Q457M, S492A… | DE | CNS | 13.4-fold increase | AAV2 |
| pAAVv128 | Q588~A592→RGNQQNTARQ | DE | Retinal pigment epithelial | 64-fold increased TE | AAV8 |
| pAAV-X1 | GNNTRSV insertion between aa Q588 and A589 | DE | brain endothelial cells | 180-fold increased TE | AAV9 |
| pAAV-X1.1 | DGAATKN substitution at aa 452-458 site, GNNTRSV insertion at aa Q588 and A589 | DE | brain endothelial cells | 22% increased than AAVX1 | AA |
| pAnc80L65 | 58 aa changed | ND | Retina | undisclosed | AAV2 and AAV8 |
| pArk313 | 454-VVNPAEG-460 | DE | T lymphocytes | 30-fold increased TE | AAV6 |
| pBI-hTFR1 | YSRIGPN insertion between aa 588 and 589 | DE | CNS | 40 to 50 times greater reporter expression | AAV9 |
| pCAP-B10 | I451-DGAATKN-Q459, S586-DGTLAVPFK-A587 | DE | blood-brain barrier | enhanced neuronal transduction 40- to 90-fold | AAV9 |
| pLICA1 | replace the AAV9 sequence of VR4 to VR8 with that of AAV-rh74 and remodeled 453-TDGRGDLGRLGP-464 | DE | Muscle | undisclosed | AAV9 |
| pMNM004 | VMSVLLVDTDATQQ of AAV2 aa 587 and 588 | DE | human dopamine neurons | undisclosed | AAV2 |
| pAAV1 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV2 | N/A | N/A | N/A | N/A | Human |
| pAAV3 | N/A | N/A | N/A | N/A | Human |
| pAAV3B | N/A | N/A | N/A | N/A | Human |
| pAAV4 | N/A | N/A | N/A | N/A | Green monkey |
| pAAV5 | N/A | N/A | N/A | N/A | Human |
| pAAV6 | N/A | N/A | N/A | N/A | Human |
| pAAV7 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV8 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV9 | N/A | N/A | N/A | N/A | Human |
| pAAV10 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV11 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV12 | N/A | N/A | N/A | N/A | Vervet monkey |
| pAAV13 | N/A | N/A | N/A | N/A | Vervet monkey |
| pAAV bb.1 | N/A | N/A | N/A | N/A | Baboon |
| pAAV bb.2 | N/A | N/A | N/A | N/A | Baboon |
| pAAV ch.5 | N/A | N/A | N/A | N/A | Chimpanzee |
| pAAV cy.2 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV cy.3 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV cy.4 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV cy.5 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV cy.6 | N/A | N/A | N/A | N/A | Cynomologus macaque |
| pAAV hu.1 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.2 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.3 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.4 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.6 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.7 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.9 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.10 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.11 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.13 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.15 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.16 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.17 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.18 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.19 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.20 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.21 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.22 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.23 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.24 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.25 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.27 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.28 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.29 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.31 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.32 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.34 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.35 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.37 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.39 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.40 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.41 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.42 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.43 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.44 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.45 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.46 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.47 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.48 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.49 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.51 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.52 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.53 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.54 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.55 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.56 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.57 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.58 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.60 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.61 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.63 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.64 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.66 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.67 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.LG15 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.S17 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T17 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T32 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T40 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T41 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T70 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T71 | N/A | N/A | N/A | N/A | Human |
| pAAV hu.T88 | N/A | N/A | N/A | N/A | Human |
| pAAV pi.1 | N/A | N/A | N/A | N/A | Pig-tailed macaque |
| pAAV pi.2 | N/A | N/A | N/A | N/A | Pig-tailed macaque |
| pAAV pi.3 | N/A | N/A | N/A | N/A | Pig-tailed macaque |
| pAAV rh.1 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.2 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.8 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.12 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.13 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.14 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.16 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.17 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.18 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.19 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.22 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.24 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.25 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.32 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.33 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.34 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.35 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.36 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.37 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.38 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.39 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.40 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.43 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.46 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.48 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.49 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.50 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.51 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.52 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.53 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.54 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.55 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.57 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.58 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.60 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.61 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.62 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV rh.64 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV VR-195 | N/A | N/A | N/A | N/A | Cynomolgus macaque |
| pAAV VR-335 | N/A | N/A | N/A | N/A | Rhesus macaque |
| pAAV-BI48 | TPQRPFI insertion between aa Q588 and A589 | RD | CNS | enhanced CNS tropism | AAV9 |
| pAAV P2-V1 | multiplex of substitutions, S264A, A493G, and N551D | RD | Retina | 2-fold increase in the fluorescent signal intensity | AAV2 |
| pAAV Pep2hSC1 | 584Q-GQRKRGDSWSE-A590 | DE | Human Schwann cells | 4.6-fold improved TE | AAV2 |
| pAAV Pep2hSC2 | 584Q-GQRRKDVDFDK-A590 | DE | Human Schwann cells | 1.4-fold improved TE | AAV2 |
| pAAV ShH10Y | I319V、N451D、D532N、H642N、Y445F | DE | Müller glial cells | undisclosed | AAV6 |
| pAAV A46-RGD4C | inserting RGD-4C peptide(CDCRGDCFC) at position 588 | RD | heparan sulfate proteoglycan | 40-fold higher on the K562 cells, 13-fold higher on the Raji cells, and 6-fold higher on the SKOV-3 cells, than gene transfer mediated by particles with wild-type capsids | AAV2 |
| pAAV2 520 | inserting RGD-4C peptide(CDCRGDCFC) at position 520 | RD | heparan sulfate proteoglycan | undisclosed | AAV2 |
| pAAV2 584 | inserting RGD-4C peptide(CDCRGDCFC) at position 584 | RD | heparan sulfate proteoglycan | undisclosed | AAV2 |
| pAAV 1.9-3 | Engineered AAV1 capsid with amino acids 445–568 being replaced with those of AAV9 | DE | human dermal fibroblasts | 5.2-fold higher transgene expression | AAV1 |
| pAAV1 RGD | D590-AS-CDCRGDCFC-ALS-P591ATGDVHAM599 | DE | Vascular endothelial cells | 50–100-fold enhancement | AAV1 |
| pAAV R484E, R585E | R484E, R585E | DE | Heart | undisclosed | AAV2 |
| pAAV2(4pMut)ΔHS | Y444F、Y500F、Y730F、T491V、R585S、R588T、R487G | DE | Retina | undisclosed | AAV2 |
| pAAV.CPP.21 | R588 TVSALFK Q589 | RD | Intravitreal | significant increase | AAV2 |
| pAAV2-588NGR | Insertion NGR at position 588 | DE | CD13 | 10-to 20-fold better than WT | AAV2 |
| pAAV2-C4 | Insertion PRGTNGP at position 587 | DE | Melanoma | 3.2-fold increased specificity | AAV2 |
| pAAV2-D10 | insertion SRGATTT at position 587 | DE | Melanoma | 3.7-fold increased specificity | AAV2 |
| pAAV2-CNH | insertion CNHRYMQMC at position 587 | DE | Plaque | 100-fold increased TE | AAV2 |
| pAAV2-CAP | insertion CAPGPSKSC at position 587 | DE | Plaque | 10-fold increased TE | AAV2 |
| pAAV2-EYH | insertion EYHHYNK at position 587 | DE | Primary human arterial SMC | 70-fold increased TE | AAV2 |
| pAAV2-GMN | insertion GMNAFRA at I-587 | DE | Brain vasculature | 70% increased TE | AAV2 |
| pAAV2-HBKO | R585A, R588A | DE | CNS | undisclosed | AAV2 |
| pAAV2-K490E | K490E | DE | Liver | 5-10 fold increased TE | AAV2 |
| pAAV2-K544E | K544E | DE | Liver | 5-10 fold increased TE | AAV2 |
| pAAV2-K549E | K549E | DE | Liver | 5-10 fold increased TE | AAV2 |
| pAAV2-K556E | K556E | DE | Liver | 5-10 fold increased TE | AAV2 |
| pAAV2-LiA | Q263A, Y444F, 449N-SEGGSLTQSSLGF-S463, 491T-TDGENNNSDF-Y500 | RD+DE | Liver | 20 fold increased TE | AAV2 |
| pAAV2-LiC | Q263A, Y500F, T503P,K507T | RD+DE | Liver | 20 fold increased TE | AAV2 |
| pAAV2-MO7A | RGDAVGV insertion between 587 and 588 | DE | Liver | 100-fold increased efficiency | AAV2 |
| pAAV2-MecA | GENQARS insertion between 587 and 588 | DE | Liver | 100-fold increased efficiency | AAV2 |
| pAAV2-MTP | MTPFPTSNEANL insertion between 587 and 588 | DE | vascular tissue | 400-fold increased efficiency | AAV2 |
| pAAV2-PFG | AAAWPFYGTPAA insertion between 587 and 588 | DE | Brain | 35-fold higher | AAV2 |
| pAAV2-PSVSPRP | PSVSPRP insertion between 587 and 588 | DE | cardiac tissue | 100-fold higher | AAV2 |
| pAAV2-PTP | 585TRKTLLPTPTS595 | DE | Plectin-1 | 24-fold higher | AAV2 |
| pAAV2-QPE | QPEHSST insertion between 587 and 588 | DE | vascular endothelium | 33-fold increase | AAV2 |
| pAAV2-VNT | VNTANST insertion between 587 and 588 | DE | vascular endothelium | 11-fold increase | AAV2 |
| pAAV2-QuadYF+TV | Y272F、Y444F、Y500F、Y730F、T491V | DE | vascular endothelial cells | undisclosed | AAV2 |
| pAAV2-SIG | Insertion SIGYPLP between 587 and 588 | DE | Human Vascular Endothelial Cells | 5.9-fold for HUVEC and 28.2-fold for HSVEC | AAV2 |
| pAAV2-VTAGRAP | VTAGRAP insertion at 588 | DE | Calu 6 | 10-fold increased | AAV2 |
| pAAV3B.ST | S663V+T492V | DE | human liver cancer cells and primary human hepatocytes | 2-10-fold increased | AAV3B |
| pAAV3B-DE5 | 24 aa substitutions | DE | Liver | 2-10-fold increased | AAV3B |
| pAAV8-1-15 | N665Q | DE | Liver, retina | undisclosed | AAV8 |
| pAAV6-RGD-Y705-731F+T492V+K531E | AAV6-RGD-Y705-731F+T492V+K531E | DE | Liver | 8-fold increased | AAV6-RGD |
| pAAV6-S663V+T492V | S663V+T492V | DE | dendritic cells | 5-fold increased | AAV6 |
| pAAV6tYF | Y445, 705 and 731F | DE | hematopoietic stem cells | undisclosed | AAV6 |
| pAAV6-Y445F | Y445F | DE | Skeletal Muscle | 8-fold increased | AAV6 |
| pAAV8 (dYF + T–V) | Y447 + 733F + T494V | DE | neonatal | 10-30 fold increased | AAV8 |
| pAAV8.N271D | N271D | DE | liver | >100-fold | AAV8 |
| pAAV9.N270D | N270D | DE | liver | 363-fold | AAV9 |
| pAAV8-2-ESGLSQS | Q587G588Q589R590-G-ESGLSQS-AQAAQ594 | DE | Lung, kidney, brain | lung (3.42-fold), kidney (9.88-fold), brain (9.08-fold) | AAV8 |
| pAAV8-Y447+Y733 | Y447+Y733F | DE | Pancreatic tissues | 7-14-fold increased | AAV8 |
| pAAV9P31 | WPTSYDA insertion between aa 588 and 589 | DE | Brain | undisclosed | AAV9 |
| pAAV9-Retro | LADQDYTKTA insertion between aa 588 and 589 | DE | neonatal | undisclosed | AAV9 |
| pAAV-Se1 | A587G, Q588-AGNGVRSVG-589A, insert A at position 591 | DE | neonatal | 3-fold increased | AAV9 |
| pAAV-Se2 | A587G, Q588-AGPGVPGRF-589A, insert A at position 591 | DE | neonatal | 8-fold increased | AAV9 |
| pAAV9-SLRSPPS | A587G-Q588, Insert AG-SLRSPPS-A Q590 A591 A592 | DE | endothelial cell | undisclosed | AAV9 |
| pAAV9-RGDLRVS | A587G-Q588, Insert AG-RGDLRVS -A Q590 A591 A592 | DE | endothelial cell | undisclosed | AAV9 |
| pAAV13-YF | Y443F, Y728F | DE | neonatal | undisclosed | AAV13 |
| pAAV13-585-7m8 | LALGETTRPA inserted after positions 585 | DE | neonatal | undisclosed | AAV13 |
| pAAV44.9 | T179S、S473N、S483C and E531D | DE | acinar cells | 150-fold higher than AAV2 | AAVrh.8 |
| pAAV44.9(E531D) | E531D | DE | Retina | undisclosed | AAV44.9 |
| pAAV-DB-3 | 7-mer aa insertion at position 590 | DE | Deep brain and cortical structures | undisclosed | AAV1 |
| pAAV-ΔIV-NGR | Q584S,NGRAHA insertion at position 588 | DE | Kaposi sarcoma cells | 10-20 fold | AAV2 |
| pAAV-DJ-S269T | S269T | DE | Liver | ~3-fold increased TE | AAV-DJ |
| pAAV-LK03-Y705+731F | Y705+731F | DE | Liver | 10-fold increased TE | AAV-LK03 |
| pAAV.S2 | DGAATKQ substitution at 451 | DE | Brain | 2.31 ± 0.37-fold higher expression | AAVrh.10 |
| pAAV1-T593K | T593K | DE | Neurons | 14- and five-fold increase | AAV1 |
| pAAV3B-V04 | 450-SNASGTAGTRGLM-462 | DE | Hepatocyte | 20-fold increased | AAV3B |
| pAAV5-PK2 | 574-QSKKSTT-578 | DE | Liver | 62-fold increased | AAV5 |
| pAAV8 BP2 | P585-ABNNNPNP | DE | Retina | undisclosed | AAV8 |
| pAAV8R | L586Q587-insert RGNLADQDYTKTARQAATAD, N385D | DE | striatal D1mediumspiny neurons | undisclosed | AAV8 |
| pAAV8R12 | L586Q587-insert RGNLADQDYTKTARQAATAD, N385D, V183E, N411S | DE | striatal D1mediumspiny neurons | undisclosed | AAV8 |
| pAAVDJK2 | AAAPRGDLAPAA insertion between 589 and 590 | DE | keratinocytes | 2-fold increased TE | AAVDJ |
| pAAV-ie-K558R | K558R | DE | cochlear | undisclosed | pAAV.ie |
| pAAV-LK03-REDH | D598H, R594E | RD | Liver | undisclosed | AAV-LK03 |
| pAAV variant 5.3 | AAV12 VP1/2 AND AAV6 VP3 | RD | CNS | 100-fold higher MOI of wild-type AAV6 vectors | AAV12 VP1/2 AND AAV6 VP3 |
| pAAVzk2 | FAPTPGP insertion after Q574 | DE | Liver | 4-11 fold higer | AAV5 |
| pBAP-AAV1 | D590_P591insBAP(TGGLNDIFEAQKIEWHEGLS) | RD | Neurons | undisclosed | AAV1 |
| pChimeric-1829 | [暂未找到] | DE | melanoma | 3-5 fold higher expression | AAV9 |
| pDMD4 | QVSHWVSGLAEGSFG insertion between 587 and 588 | DE | HER-2 | undisclosed | AAV2 |
| peAAV9 | LSLEEEWAQVECEVYGRG CPSGSLDESFYDWFERQLGAG insertion between aa 589 and 590 | DE | Muscle | 18-fold increased | AAV9 |
| pHAE-2 | [暂时空置] | DE | Human Ciliated Airway Epithelium | [暂时空置] | [暂时空置] |
| pAAV.IVT18 | After aa 587 | DE | Retina | [暂时空置] | AAV2 |
| pAAV LP2-10 | E531K, R725H, N735P | DE | Liver | higer TD | AAV serotypes 2, 6, 8, and 9 |
| pAAV MDV1A | A587Q588-RSVGSVY-A596 | DE | CNS | 2-3 fold increase | AAV9 |
| pAAV MDV1B | A587Q588-KTVGTVY-A596 | DE | CNS | 2-3 fold increase | AAV9 |
| pAAV9-PAL2 | Q585-EVGPTQGTVR | DE | CNS | 4-6-fold increase | AAV9 |
| pAAV MG1.1 | A587L-MTPPKTT, Q588S | DE | microglia | undisclosed | AAV9 |
| pAAV MG1.2 | A587-TEPPKTT, Q588S | DE | microglia | undisclosed | AAV9 |
| pAAV MV50 | G257R, S705G | DE | Liver | 10-fold increased TE | AAV5 |
| pAAV MV53 | Q179R, G257R | DE | Liver | 10-fold increased TE | AAV5 |
| pAAV NHP#9 | 583~LALIQDSMRA | DE | Retina | 12-fold increase | AAV2 |
| pAAV NHP#26 | ~583-LQRGVRIPSVLEVNGQ | DE | Retina | undisclosed | AAV2 |
| pAAV RC-C02 | 587‑LALGETTRPA‑588, I240T‑V708I | DE | Retina | undisclosed | AAV2 |
| pAAV RC-C14 | 587‑LALGDVTRPA,I240T‑V708I | DE | Retina | undisclosed | AAV2 |
| pAAV Rec2.V7 | F503Y/Y708D/K709I | DE | Adipose | 4.5-fold increase | REC2 |
| pAAV RhAAV4282 | Multilocus mutation | DE | Tissue | undisclosed | AAV7 |
| pAAV rRGD453ko | G453-ACDCRGDCDFCATTT, R585A,R588A | DE | human cervix epitheloid cell | ~40-fold increase | AAV2 |
| pAAV v8-1-15 | N665Q | RD | hepatocyte | undisclosed | AAV8 |
| pAAV vS3-1-2 | T451N | RD | hepatocyte | undisclosed | AAVS3 |
| pAAV VCAP-102 | G453-ins HDSPHKSG | DE | CNS | 20- to 400-fold increased | AAV9 |
| pAAV Vivec-N002 | GNYRGNP(gggaattataggggtaatccg) insertion between Q588 and A589 | DE | CNS | undisclosed | AAV9 |
| pAAV XL32.1 | Multilocus mutation | DE | CNS | undisclosed | AAV2 |
| pAAV RC-V25 | RQGVPTQPG insertion between 578 and 588 | DE | Retina | undisclosed | AAV2 |
| pAAVYC5 | S424G、S456G and S468G | DE | Retina | 2.8–4 folds higher | AAVXL32 |
| pAAV-T1 | SEAVEGKEK | DE | T cells | 5-fold increased TE | AAV6 |
| pAAV-T2 | SEAVEGKEK | DE | T cells | 5-fold increased TE | AAV6 |
| pAAV-DJ-N589X | N589X(TAG) | DE | Fibroblasts | 5-15 fold increased TE | AAV-DJ |
| pAAV-cMG | changes on AAV9 capsid: K449R, A589D; insertion of QRPPRPA between Q588 and D589 | DE | microglia | undisclosed | AAV9 |
| pAAV.CAP-B22 | 7 amino acid substitution between VP1 452 and VP1 460 from NGSGQNQ to DGQSSKS | DE | Brain | undisclosed | AAV-PHP.eB |
| pAAV-PHP.V1 | AQ588-TALKPFL-A589Q | DE | CNS | undisclosed | AAV9 |
| pSR646 | modified AAV-2 rep78, modified AAV-6 cap | NA | NA | undisclosed | AAV6 |
| pAAV-cMG.WPP | changes on AAV9 capsid: K449R; insertion of WPPKTTS between Q588 and A589 | DE | microglia | undisclosed | AAV9 |
| pAAV-cMG.QRP | changes on AAV9 capsid: K449R; insertion of QRPPREP between Q588 and A589 | DE | microglia | undisclosed | AAV9 |
| pAAV.FUS.3 | AAV9 modified with 7-amino acid insertion between AA position 588 and 589 of VP1 | DE | CNS | 10-fold increased TE | AAV9 |
| pAAV-BI-hTFR1-4 | AAV9 modified with YHRLSNN insertion between AA position 588 and 589 of VP1 | DE | CNS | 40 to 50 times greater than AAV9 | AAV9 |
| pAAV-BI-hTFR1-3 | AAV9 modified with YSRLNKD insertion between AA position 588 and 589 of VP1 | DE | CNS | 40 to 50 times greater than AAV9 | AAV9 |
| pAAV-BI-hTFR1-2 | AAV9 modified with YSRLNMN insertion between AA position 588 and 589 of VP1 | DE | CNS | 40 to 50 times greater than AAV9 | AAV9 |
| pAAV.cc84-mut | 7 amino acid substitution between VP1 586 and VP1 592 from SAQAQAQ to NAVGALS | DE | Brain ECs | undisclosed | AAV9 |
| pAAV-M.Fas.4 | 7 amino acid(VVSDYTV) insertion between vp1 588 and vp1 589 | DE | CNS | undisclosed | AAV9 |
| pAAV-M.Fas.3 | 7 amino acid(RVDPSGL) insertion between vp1 588 and vp1 589 | DE | CNS | undisclosed | AAV9 |
| pAAV-M.Fas.2 | 7 amino acid(STIPTMK) insertion between vp1 588 and vp1 589 | DE | CNS | undisclosed | AAV9 |
| pAAV-M.Fas.1 | 7 amino acid(TDALTTK) insertion between vp1 588 and vp1 589 | DE | CNS | undisclosed | AAV9 |
| pAAV-PAL1D | PTQGTFR insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV-PAL1C | PTQGTLR insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV-PAL1B | PSQGTLR insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV-PAL1A | PTQGTVR insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV-M.Mus.2 | REQQKLW insert between amino acids 588 and 589 of AAV9 VP1, A587D, Q588G | DE | CNS | undisclosed | AAV9 |
| pAAV-M.Mus.1 | WVLPSGG insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV-PHP.AX | S586-DGTLAVPFK-A589 | DE | CNS | undisclosed | AAV9 |
| piCAP-ROOT | IPNMGDH insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV-S in pAR9 | STTLYSP insert between amino acids 588 and 589 of AAV9 VP1 | DE | CNS | undisclosed | AAV9 |
| pAAV2-N587X | N589X(TAG) | DE | Fibroblasts | 5-15 fold increased | AAV2 |
| pAAV2_586_PLGLAR | G586-AGPLGLARGDDDDGPLGLARGA-N587 | DE | metastatic epithelial ovarian cancer | undisclosed | AAV2 |
| pAAV PHP.B4 | TLQIPFK insert between amino acids 588 and 589 of AAV9 VP1 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV PHP.B3 | FTLTTPK insert between amino acids 588 and 589 of AAV9 VP1 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV PHP.B2 | SVSKPFL insert between amino acids 588 and 589 of AAV9 VP1 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV PHP.v2 | TTLKPFL insert between amino acids 588 and 589 of AAV9 VP1 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV‑PM166 | TDGNLANPFK subsititution from aa 586 to aa588 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV‑PM167 | SEGTLAQPFK subsititution from aa 586 to aa588 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV‑PM170 | SAGTIAQPFK subsititution from aa 586 to aa588 | DE | brain vascular cells | undisclosed | AAV9 |
| pAAV‑PM171 | QAGTLQQPFK subsititution from aa 586 to aa588 | deep learning | brain vascular cells | undisclosed | AAV9 |
| pAAV MLIV.K | AAAKGGALGGAA insert between amino acids 587 and 588 of AAV2 VP1 | DE | Liver | 14-16-fold higher | AAV2 |
| pAAV MLIV.A | AAAASTGPHTAA insert between amino acids 587 and 588 of AAV2 VP1 | DE | Liver | 5-6-fold higher | AAV2 |
| pAAV2.5 | AAV2 to AAV1, Q263A, T265 (insertion), N706A, V709A, and T717N, | DE | antibody escape phenotype | undisclosed | AAV2 |
| pAAV-Ep+ | ERDRTRG insertion at 590 | DE | key brain tissues | 22.05-fold increase in TE | AAV1 |
| pAAV M6 | Q588-AMPRTPG-A589 | DE | blood–brain barrier | 5 times higher titer than AAV-PHP.Eb | AAV9 |
| pAAV M8 | Q588-TMPRHPP-A589 | DE | blood–brain barrier | 3 times higher titer than AAV-PHP.Eb | AAV9 |
| pAAV2-LSS | LPSSLQK insertion between N587 and R588 | DE | CNS | markedly improved brain tropism | AAV2 |
| pAAV2-PPS | DSPAHPS insertion between N587 and R588 | DE | CNS | markedly improved brain tropism | AAV2 |
| pAAV2-TLH | GWTLHNK insertion between N587 and R588 | DE | CNS | markedly improved brain tropism | AAV2 |
| pAAV2-DMD6 | LSHTSGRVEGSVSLL insertion between N587 and R588 | DE | vaccine | undisclosed | AAV2 |
| pAAV-APVTRPA | N587Q, APVTRPA insertion behind R588 | DE | tumor cells | undisclosed | AAV2 |
| pAAV-DLSNLTR | N587Q , DLSNLTR insertion behind R588 | DE | tumor cells | undisclosed | AAV2 |
| pAAV-NQVGSWS | N587Q , NQVGSWS insertion behind R588 | DE | leukemia cell | up to 500-fold better transduction efficiency | AAV2 |
| pAAV-EARVRPP | N587Q , EARVRPP insertion behind R588 | DE | tumor cells | up to 36-fold increase in CML transduction efficiency | AAV2 |
| pAAV-NSVSLYT | N587Q , NSVSLYT insertion behind R588 | DE | tumor cells (CML) | up to 36-fold increase in CML transduction efficiency | AAV2 |
| pAAV-LS1 | N587Q , NDVRSAN insertion behind R588 | DE | tumor cells (CML), CD34+ cells | up to eightfold higher than AAV2 | AAV2 |
| pAAV-LS2 | N587Q , NESRVLS insertion behind R588 | DE | tumor cells (CML), CD34+ cells | up to eightfold higher than AAV2 | AAV2 |
| pAAV-LS3 | N587Q , NRTWEQQ insertion behind R588 | DE | tumor cells (CML), CD34+ cells | up to eightfold higher than AAV2 | AAV2 |
| pAAV-LS4 | N587Q , NSVQSSW insertion behind R588 | DE | tumor cells (CML), CD34+ cells | up to eightfold higher than AAV2 | AAV2 |
| pAAV-RGDLGLS | N587Q, RGDLGLS insertion behind R588 | DE | tumor cells | 3.5~17.8 fold higher | AAV2 |
| pAAV-RGDMSRE | N587Q, RGDMSRE insertion behind R588 | DE | tumor cells | 3.5~17.8 fold higher | AAV2 |
| pAAV-EYRDSSG | N587Q, EYRDSSG insertion behind R588 | DE | tumor cells | 3.5~17.8 fold higher | AAV2 |
| pAAV-DLGSARA | N587Q, DLGSARA insertion behind R588 | DE | tumor cells | 3.5~17.8 fold higher | AAV2 |
| pAAV-GPQGKNS | N587Q, GPQGKNS insertion behind R588 | DE | tumor cells | AAV2 | |
| pAAV-NSSRDLG | N587Q, NSSRDLG insertion behind R589 | DE | tumor cells | undisclosed | AAV2 |
| pAAV-PT1 | TEN to EKH at 376-378 in VR-III, S518K in VR-VI, and ND to SE at 694-695, Q697T and T706A in VR-IX | DE | Retina | undisclosed | AAV5 |
| pAAV.eM | deleting residues 585–587,R585A, S585-NSRGDYNSLR-Q596 | DE | Muscle | undisclosed | AAV9 |
| pAAVC7 | Multilocus mutation | DE | Cardiotropism | undisclosed | AAV9 |
| pAAV-hCA4-IV77 | insertion of STQFRGM between amino acids 588 and 589 of AAV9 VP1 | DE | Brain | 100-fold greater brain transduction | AAV9 |
| pAAV BRC06 | GSPTFYS replace of 587 AQAQ 590 | DE | CNS | 1,482-fold brain enhancement with a 92-fold liver reduction relative to AAV9. | AAV9 |
| pAAV MC5 | insertion IRENAQP after aa588 | DE | Microglia | 3.74-fold enrichment | AAV9 |
AE,antibody evasion; DE, directed evolution; GalNAc, N-acetylgalactosamine; ND, natural discovery; RD, rational design; SP, specificity; TE, transduction efficiency.